Human LACRT(Lacritin) ELISA Kit
To Order Contact us below: Margalida@envite.org
Human Lacritin (LACRT) ELISA Kit |
RD-LACRT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Lacritin (LACRT) ELISA Kit |
20-abx152147 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Lacritin (LACRT) ELISA Kit |
SEC576Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
SEC576Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
SEC576Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
SEC576Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lacritin (LACRT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lacritin (LACRT) in saliva, tears and other biological fluids. |
Human Lacritin (LACRT) ELISA Kit |
4-SEC576Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Lacritin elisa. Alternative names of the recognized antigen: Extracellular glycoprotein lacritin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lacritin (LACRT) in samples from saliva, tears and other biological fluids with no significant corss-reactivity with analogues from other species. |
Lacritin (LACRT) Antibody |
20-abx113422 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Lacritin (LACRT) Antibody |
20-abx128613 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Lacritin (LACRT) Antibody |
20-abx173283 |
Abbexa |
|
|
|
Recombinant Lacritin (LACRT) |
4-RPC576Hu01 |
Cloud-Clone |
-
EUR 519.33
-
EUR 242.00
-
EUR 1672.48
-
EUR 624.16
-
EUR 1148.32
-
EUR 410.00
-
EUR 4031.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9GZZ8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 44.7kDa
- Isoelectric Point: 6.1
|
Description: Recombinant Human Lacritin expressed in: E.coli |
Human Lacritin (LACRT) Protein |
20-abx167137 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2249.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Lacritin (LACRT) CLIA Kit |
20-abx493773 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human LACRT (Lacritin) |
ELK2907 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lacritin (LACRT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lacritin (LACRT).
- Show more
|
Description: A sandwich ELISA kit for detection of Lacritin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human LACRT (Extracellular glycoprotein lacritin) ELISA Kit |
ELI-42678h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
KTE61868-48T |
Abbkine |
48T |
EUR 332 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
KTE61868-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Extracellular glycoprotein lacritin (LACRT) |
KTE61868-96T |
Abbkine |
96T |
EUR 539 |
- Lacritin is a 12.3 kDa glycoprotein encoded in humans by the LACRT gene. Lacritin is a secreted protein found in tears and saliva. Lacritin also promotes tear secretion and proliferation of some epithelial cells.
Lacritin is thus a prosecretory mitog
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Extracellular glycoprotein lacritin (LACRT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Extracellular Glycoprotein Lacritin (LACRT) Antibody |
abx234671-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse) |
4-PAC576Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT) |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC |
4-PAC576Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC576Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Biotin. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC576Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with Cy3. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC576Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with FITC. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC576Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with HRP. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), PE |
4-PAC576Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with PE. |
Lacritin (LACRT) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC576Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LACRT (Glu20~Ala138)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Lacritin (LACRT). This antibody is labeled with APC-Cy7. |
LACRT ELISA Kit (Human) (OKCD00685) |
OKCD00685 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Modulates secretion by lacrimal acinar cells. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL |
LACRT ELISA Kit (Human) (OKDD00367) |
OKDD00367 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
LACRT antibody |
70R-18201 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LACRT antibody |
LACRT Antibody |
1-CSB-PA012715GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LACRT. Recognizes LACRT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
LACRT siRNA |
20-abx922200 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human LACRT shRNA Plasmid |
20-abx963898 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LACRT Recombinant Protein (Human) |
RP017461 |
ABM |
100 ug |
Ask for price |
LACRT Recombinant Protein (Human) |
RP017464 |
ABM |
100 ug |
Ask for price |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
LACRT Polyclonal Antibody |
28656-100ul |
SAB |
100ul |
EUR 252 |
LACRT Polyclonal Antibody |
28656-50ul |
SAB |
50ul |
EUR 187 |
LACRT Rabbit pAb |
A14632-100ul |
Abclonal |
100 ul |
EUR 308 |
LACRT Rabbit pAb |
A14632-200ul |
Abclonal |
200 ul |
EUR 459 |
LACRT Rabbit pAb |
A14632-20ul |
Abclonal |
20 ul |
EUR 183 |
LACRT Rabbit pAb |
A14632-50ul |
Abclonal |
50 ul |
EUR 223 |
LACRT cloning plasmid |
CSB-CL887939HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 417
- Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
- Show more
|
Description: A cloning plasmid for the LACRT gene. |
LACRT cloning plasmid |
CSB-CL887939HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 417
- Sequence: atgaaatttaccactctcctcttcttggcagctgtagcaggggccctggtctatgctgaagatgcctcctctgactcgacgggtgctgatcctgcccaggaagctgggacctctaagcctaatgaagagatctcaggtccagcagaaccagcttcacccccagagacaaccacaac
- Show more
|
Description: A cloning plasmid for the LACRT gene. |
anti- LACRT antibody |
FNab04671 |
FN Test |
100µg |
EUR 585 |
- Immunogen: lacritin
- Uniprot ID: Q9GZZ8
- Gene ID: 90070
- Research Area: Epigenetics, Signal Transduction
|
Description: Antibody raised against LACRT |
Anti-LACRT antibody |
STJ116839 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium. |
LACRT ORF Vector (Human) (pORF) |
ORF005821 |
ABM |
1.0 ug DNA |
EUR 95 |
LACRT ORF Vector (Human) (pORF) |
ORF005822 |
ABM |
1.0 ug DNA |
EUR 95 |
LACRT Polyclonal Conjugated Antibody |
C28656 |
SAB |
100ul |
EUR 397 |
LACRT sgRNA CRISPR Lentivector set (Human) |
K1192801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
LACRT sgRNA CRISPR Lentivector (Human) (Target 1) |
K1192802 |
ABM |
1.0 ug DNA |
EUR 154 |
LACRT sgRNA CRISPR Lentivector (Human) (Target 2) |
K1192803 |
ABM |
1.0 ug DNA |
EUR 154 |
LACRT sgRNA CRISPR Lentivector (Human) (Target 3) |
K1192804 |
ABM |
1.0 ug DNA |
EUR 154 |
LACRT Protein Vector (Human) (pPB-C-His) |
PV023281 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPB-N-His) |
PV023282 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-HA) |
PV023283 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-His) |
PV023284 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPB-C-His) |
PV023285 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPB-N-His) |
PV023286 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-HA) |
PV023287 |
ABM |
500 ng |
EUR 329 |
LACRT Protein Vector (Human) (pPM-C-His) |
PV023288 |
ABM |
500 ng |
EUR 329 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
LACRT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV711849 |
ABM |
1.0 ug DNA |
EUR 316 |
LACRT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV711853 |
ABM |
1.0 ug DNA |
EUR 316 |
Human LACRT(Lacritin) ELISA Kit