Human VSNL1(Visinin Like Protein 1) ELISA Kit

To Order Contact us below: Margalida@envite.org

Human Visinin Like Protein 1 (VSNL1) ELISA Kit
RDR-VSNL1-Hu-96Tests 96 Tests
EUR 756
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
RD-VSNL1-Hu-48Tests 48 Tests
EUR 521
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
RD-VSNL1-Hu-96Tests 96 Tests
EUR 723
VSNL1 Visinin-Like Protein-1 Human Recombinant Protein
PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.
Visinin-like protein 1/VSNL1
CH22114 100 ul
EUR 435
Visinin-like protein 1/VSNL1
MO22132 100 ul
EUR 435
Visinin-like protein 1/VSNL1
MO22133 100 ul
EUR 409
Human Visinin-like protein 1 (VSNL1)
1-CSB-EP025933HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Visinin-like protein 1(VSNL1) expressed in E.coli
Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Visinin like protein 1(VSNL1) ELISA kit
E01V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
20-abx153492
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
abx250910-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human VSNL1/ Visinin-like protein 1 ELISA Kit
E2674Hu 1 Kit
EUR 571
Human VSNL1(Visinin-like protein 1) ELISA Kit
EH1618 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P62760
  • Alias: VSNL1/Visinin-like protein 1/VILIP/VLP-1/Hippocalcin-like protein 3/HLP3/HPCAL3/HUVISL1/VILIP-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Visinin- like protein 1, VSNL1 ELISA KIT
ELI-04745h 96 Tests
EUR 824
Human Visinin-like protein 1 (VSNL1) ELISA Kit
abx570658-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Visinin Like Protein 1(VSNL1)ELISA Kit
QY-E01517 96T
EUR 361
Human Visinin Like Protein 1 ELISA Kit (VSNL1)
RK02511 96 Tests
EUR 521
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
SEG677Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Visinin Like Protein 1 (VSNL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Visinin Like Protein 1 (VSNL1) in Tissue homogenates, cerebrospinal fluid and other biological fluids.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
SEG677Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Visinin Like Protein 1 (VSNL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Visinin Like Protein 1 (VSNL1) in Tissue homogenates, cerebrospinal fluid and other biological fluids.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
SEG677Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Visinin Like Protein 1 (VSNL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Visinin Like Protein 1 (VSNL1) in Tissue homogenates, cerebrospinal fluid and other biological fluids.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
SEG677Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Visinin Like Protein 1 (VSNL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Visinin Like Protein 1 (VSNL1) in Tissue homogenates, cerebrospinal fluid and other biological fluids.
Human Visinin Like Protein 1 (VSNL1) ELISA Kit
4-SEG677Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Visinin Like Protein 1 elisa. Alternative names of the recognized antigen: HLP3
  • VISL1
  • HPCAL3
  • HUVISL1
  • VILIP
  • VILIP-1
  • VLP-1
  • Hippocalcin Like Protein 3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Visinin Like Protein 1 (VSNL1) in samples from Tissue homogenates, cerebrospinal fluid and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Visinin Like Protein 1 (VSNL1) Protein
20-abx167842
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
20-abx007357
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
abx026653-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
abx026653-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
20-abx005303
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
20-abx003095
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VSNL1) Antibody
abx036593-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Visinin Like Protein 1 (VSNL1) Antibody
20-abx128873
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Visinin Like Protein 1 (VSNL1) Antibody
20-abx129596
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Visinin Like Protein 1 (VSNL1) Antibody
20-abx175103
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Visinin-Like Protein 1 (VSNL1) Antibody
20-abx320836
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Visinin Like Protein 1 (VSNL1)
4-RPG677Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62760
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.4kDa
  • Isoelectric Point: 6.1
Description: Recombinant Human Visinin Like Protein 1 expressed in: E.coli
Recombinant Visinin Like Protein 1 (VSNL1)
4-RPG677Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P62761
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.5kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Visinin Like Protein 1 expressed in: E.coli
Rat Visinin like protein 1(VSNL1) ELISA kit
E02V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Visinin like protein 1(VSNL1) ELISA kit
E02V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Visinin like protein 1(VSNL1) ELISA kit
E02V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Visinin like protein 1(VSNL1) ELISA kit
E04V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Visinin like protein 1(VSNL1) ELISA kit
E04V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Visinin like protein 1(VSNL1) ELISA kit
E04V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Visinin like protein 1(VSNL1) ELISA kit
E03V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Visinin like protein 1(VSNL1) ELISA kit
E03V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Visinin like protein 1(VSNL1) ELISA kit
E03V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Visinin like protein 1(VSNL1) ELISA kit
E08V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Visinin like protein 1(VSNL1) ELISA kit
E08V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Visinin like protein 1(VSNL1) ELISA kit
E08V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Visinin like protein 1(VSNL1) ELISA kit
E06V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Visinin like protein 1(VSNL1) ELISA kit
E06V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Visinin like protein 1(VSNL1) ELISA kit
E06V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Visinin like protein 1(VSNL1) ELISA kit
E07V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Visinin like protein 1(VSNL1) ELISA kit
E07V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Visinin like protein 1(VSNL1) ELISA kit
E07V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Visinin like protein 1(VSNL1) ELISA kit
E09V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Visinin like protein 1(VSNL1) ELISA kit
E09V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Visinin like protein 1(VSNL1) ELISA kit
E09V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Vsnl1/ Visinin-like protein 1 ELISA Kit
E1685Mo 1 Kit
EUR 571
Bovine Visinin- like protein 1, VSNL1 ELISA KIT
ELI-04741b 96 Tests
EUR 928
Mouse Visinin- like protein 1, Vsnl1 ELISA KIT
ELI-04742m 96 Tests
EUR 865
Chicken Visinin- like protein 1, VSNL1 ELISA KIT
ELI-04743c 96 Tests
EUR 928
Cow Visinin-like protein 1 (VSNL1) ELISA Kit
abx516983-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Visinin-like protein 1 (VSNL1) ELISA Kit
abx516984-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Visinin-like protein 1 (VSNL1) ELISA Kit
abx516986-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Visinin-like protein 1 (VSNL1) ELISA Kit
abx516987-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Visinin-like Protein 1 (VSNL1) Antibody
13017-05011 150 ug
EUR 217
Human Visinin Like Protein 1 (VSNL1) CLIA Kit
20-abx495271
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human VSNL1 (Visinin Like Protein 1)
ELK3093 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Visinin Like Protein 1 (VSNL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Vis
  • Show more
Description: A sandwich ELISA kit for detection of Visinin Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Visinin-like protein 1 (VSNL1)
KTE60045-48T 48T
EUR 332
  • VSNL1 is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellula
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Visinin-like protein 1 (VSNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Visinin-like protein 1 (VSNL1)
KTE60045-5platesof96wells 5 plates of 96 wells
EUR 2115
  • VSNL1 is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellula
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Visinin-like protein 1 (VSNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Visinin-like protein 1 (VSNL1)
KTE60045-96T 96T
EUR 539
  • VSNL1 is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellula
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Visinin-like protein 1 (VSNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Mouse Visinin Like Protein 1 (VSNL1) Protein
20-abx167846
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Human VSNL1 (Visinin Like Protein 1) Kit
E-EL-H5516 1 plate of 96 wells
EUR 534
  • Gentaur's VSNL1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VSNL1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VSNL1 (Visinin Like Protein 1) Kit in samples from Serum, Plasma, Cell supernatant
Guinea pig Visinin like protein 1(VSNL1) ELISA kit
E05V0076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Visinin like protein 1(VSNL1) ELISA kit
E05V0076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Visinin like protein 1(VSNL1) ELISA kit
E05V0076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Visinin like protein 1(VSNL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Anti-Visinin-Like Protein 1 (VSNL1) antibody
STJ120272 100 µl
EUR 526
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse)
4-PAG677Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1)
Human Visinin-like Protein 1 (VSNL1) Antibody (Biotin Conjugate)
13017-05021 150 ug
EUR 276
Monoclonal Visinin-Like Protein 1 (VSNL1) Antibody, Clone: 2D11
AMM02597G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Visinin-Like Protein 1 (VSNL1). The antibodies are raised in Mouse and are from clone 2D11. This antibody is applicable in WB and IF
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), APC
4-PAG677Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with APC.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), Biotinylated
4-PAG677Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with Biotin.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), Cy3
4-PAG677Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with Cy3.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), FITC
4-PAG677Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with FITC.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), HRP
4-PAG677Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with HRP.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), PE
4-PAG677Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with PE.
Human Visinin-like Protein 1 (VSNL1) AssayLite Antibody (FITC Conjugate)
13017-05041 150 ug
EUR 428
Human Visinin-like Protein 1 (VSNL1) AssayLite Antibody (RPE Conjugate)
13017-05051 150 ug
EUR 428
Human Visinin-like Protein 1 (VSNL1) AssayLite Antibody (APC Conjugate)
13017-05061 150 ug
EUR 428
Human Visinin-like Protein 1 (VSNL1) AssayLite Antibody (PerCP Conjugate)
13017-05071 150 ug
EUR 471
Recombinant Human Visinin-Like Protein 1/VILIP/VSNL1 (N-6His)
C265-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 20mM NaCl, pH 8.0.
Recombinant Human Visinin-Like Protein 1/VILIP/VSNL1 (N-6His)
C265-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 20mM NaCl, pH 8.0.
Recombinant Human Visinin-Like Protein 1/VILIP/VSNL1 (N-6His)
C265-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 20mM NaCl, pH 8.0.
Recombinant Human Visinin-Like Protein 1/VILIP/VSNL1 (N-6His)
C265-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris, 20mM NaCl, pH 8.0.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG677Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 linked with ESLRPHSSTT TTTTEIRLLT KPERKLSWLL PPLSNN(Pro39~Leu184+ESLRPHSSTTTTTTEIRLLTKPERKLSWLLPPLSNN)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Visinin Like Protein 1 (VSNL1). This antibody is labeled with APC-Cy7.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAG677Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1)
Anti-Visinin-like Protein 1 Monoclonal Antibody
M06959-1 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAG677Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with APC.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAG677Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with Biotin.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAG677Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with Cy3.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAG677Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with FITC.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAG677Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with HRP.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAG677Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with PE.
Visinin Like Protein 1 (VSNL1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC-Cy7
4-PAG677Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VSNL1 (Pro39~Leu184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Visinin Like Protein 1 (VSNL1). This antibody is labeled with APC-Cy7.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Visinin-Like Protein-1 Protein
20-abx260465
  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.
Visinin-Like Protein-1 Protein
20-abx263044
  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Recombinant Human Visinin-Like Protein-1
7-06874 10µg Ask for price
Recombinant Human Visinin-Like Protein-1
7-06875 50µg Ask for price
Recombinant Human Visinin-Like Protein-1
7-06876 1mg Ask for price
ELISA kit for Mouse Visinin-like protein 1
EK3421 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Visinin-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
Visinin-Like 1 Antibody
20-abx116616
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VILIP1) Antibody
20-abx141934
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VILIP1) Antibody
abx028510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Visinin-Like Protein 1 (VILIP1) Antibody
abx028510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Anti-Visinin-like Protein 1 Antibody
M06959-2 100ul
EUR 397
Description: Rabbit Polyclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Visinin-like Protein 1 Antibody
M06959-3 100ul
EUR 397
Description: Chicken Polyclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Visinin-Like Protein 1 (VILIP-1) Antibody
abx239405-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Vsnl1/ Rat Vsnl1 ELISA Kit
ELI-04744r 96 Tests
EUR 886
Recombinant Human Visinin-Like Protein-1 His Tag
7-06877 2µg Ask for price
Recombinant Human Visinin-Like Protein-1 His Tag
7-06878 10µg Ask for price
Recombinant Human Visinin-Like Protein-1 His Tag
7-06879 1mg Ask for price
Anti-Visinin-like Protein 1 Monoclonal Antibody
M06959 100ul
EUR 397
Description: Mouse Monoclonal Visinin-like Protein 1 Antibody. Validated in IF, IHC, WB and tested in Bovine, Human, Mouse, Pig, Rat.
Human VSNL1 ELISA Kit
ELA-E1450h 96 Tests
EUR 824
VSNL1 ELISA KIT|Human
EF007393 96 Tests
EUR 689
Visinin-Like Protein 3 (VILIP3) Antibody
abx028511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Visinin-Like Protein 3 (VILIP3) Antibody
abx028511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
VSNL1 Recombinant Protein (Human)
RP034453 100 ug Ask for price
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1 96 Well Plate
EUR 477
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes
mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK
PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 
FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK
PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).
IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9
PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
VSNL1 antibody
70R-21283 50 ul
EUR 435
Description: Rabbit polyclonal VSNL1 antibody
VSNL1 Antibody
47458-100ul 100ul
EUR 252
VSNL1 Antibody
1-CSB-PA025933DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VSNL1. Recognizes VSNL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
VSNL1 Antibody
1-CSB-PA025933GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VSNL1. Recognizes VSNL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
VSNL1 siRNA
20-abx939571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSNL1 siRNA
20-abx939572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
VSNL1 Recombinant Protein (Rat)
RP237089 100 ug Ask for price
VSNL1 Recombinant Protein (Mouse)
RP185015 100 ug Ask for price
GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein
PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.
Human VSNL1 shRNA Plasmid
20-abx955095
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9
PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Anti-Vangl1/Vang Like Protein 1 Antibody
A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.
VSNL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2621302 1.0 ug DNA
EUR 154
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-100ug
QP6883-ec-100ug 100ug
EUR 408
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-10ug
QP6883-ec-10ug 10ug
EUR 200
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-1mg
QP6883-ec-1mg 1mg
EUR 1632
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-200ug
QP6883-ec-200ug 200ug
EUR 634
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-500ug
QP6883-ec-500ug 500ug
EUR 1060
Recombinant Human VILIP-1/ VSNL1 Protein, GST, E.coli-50ug
QP6883-ec-50ug 50ug
EUR 263
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools
Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit
EK2802-1 96 Well Plate
EUR 477
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Fibrinogen Like Protein 1 ELISA kit
E01F0080-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Follistatin Like Protein 1 ELISA kit
E01F0385-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Follistatin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Tolloid Like Protein 1 ELISA kit
E01T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Angiopoietin Like Protein 1 ELISA kit
E01A0504-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Angiopoietin Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
VSNL1 Conjugated Antibody
C47458 100ul
EUR 397
VSNL1 cloning plasmid
CSB-CL025933HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 576
  • Sequence: atggggaagcagaatagcaaactggcccctgaagtgatggaggacctggtgaagagcacagagtttaatgagcatgaactcaagcagtggtacaaaggatttctcaaggactgtccaagtgggaggctaaatctcgaggaatttcagcagctctatgtgaagttctttccttatgg
  • Show more
Description: A cloning plasmid for the VSNL1 gene.
VSNL1 Rabbit pAb
A4185-100ul 100 ul
EUR 308
VSNL1 Rabbit pAb
A4185-200ul 200 ul
EUR 459
VSNL1 Rabbit pAb
A4185-20ul 20 ul Ask for price
VSNL1 Rabbit pAb
A4185-50ul 50 ul Ask for price
VSNL1 Rabbit pAb
A6999-100ul 100 ul
EUR 308
VSNL1 Rabbit pAb
A6999-200ul 200 ul
EUR 459
VSNL1 Rabbit pAb
A6999-20ul 20 ul
EUR 183
VSNL1 Rabbit pAb
A6999-50ul 50 ul
EUR 223
VSNL1 Rabbit pAb
A2797-100ul 100 ul
EUR 308
VSNL1 Rabbit pAb
A2797-200ul 200 ul
EUR 459
VSNL1 Rabbit pAb
A2797-20ul 20 ul
EUR 183
VSNL1 Rabbit pAb
A2797-50ul 50 ul
EUR 223
pENTR223-VSNL1 vector
PVT11858 2 ug
EUR 304
Anti-VSNL1 antibody
STJ26100 100 µl
EUR 277
Description: This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.
Anti-VSNL1 antibody
STJ26101 100 µl
EUR 277
Description: This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.
Anti-VSNL1 antibody
STJ29079 100 µl
EUR 277
Description: This gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. The encoded protein is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

Human VSNL1(Visinin Like Protein 1) ELISA Kit